Skip to main content
참고 http://sourceforge.net/apps/mediawiki/cloudburst-bio/index.php?title=Sample_Results



[hadoop@skcc-nebdap02 CloudBurst-1.1.0]$ ll
total 24332
-rw-r--r-- 1 hadoop hadoop 1995984 Jun 15 17:19 100k.3.txt
-rw-r--r-- 1 hadoop hadoop 1995984 Dec 5 2008 100k.3.txt.gold
-rw-r--r-- 1 hadoop hadoop 4493593 Jun 15 17:06 100k.br
-rw-r--r-- 1 hadoop hadoop 4388895 Dec 5 2008 100k.fa
-rw-r--r-- 1 hadoop hadoop 1177790 Jun 15 17:06 100k.fa.map
-rw-r--r-- 1 hadoop hadoop    8337 Dec 5 2008 cloudburst.err.gold
-rw-r--r-- 1 hadoop hadoop   57014 Jul 9 2010 CloudBurst.jar
-rw-r--r-- 1 hadoop hadoop 4067962 Jul 9 2010 ConvertFastaForCloud.jar
-rw-r--r-- 1 hadoop hadoop 4067959 Jul 9 2010 PrintAlignments.jar
-rw-r--r-- 1 hadoop hadoop    1452 Jul 9 2010 README.txt
drwxr-xr-x 2 hadoop hadoop     4096 Jun 15 17:19 results
-rw-r--r-- 1 hadoop hadoop 579773 Jun 15 17:06 s_suis.br
-rw-r--r-- 1 hadoop hadoop 2040970 Dec 5 2008 s_suis.fa
-rw-r--r-- 1 hadoop hadoop     21 Jun 15 17:06 s_suis.fa.map
[hadoop@skcc-nebdap02 CloudBurst-1.1.0]$ cat README.txt
Sample data for CloudBurst
==========================


CloudBurst has several parameters to control the sensitivity of the
alignment algorithm. Here it finds the unambiguous best alignment for
100,000 reads allowing up to 3 mismatches when mapping to the corresponding
S. suis genome.




== Sample input data


s_suis.fa: Streptococcus suis reference genome sequence
100k.fa:   100,000 36bp Illumina reads available from
       http://www.sanger.ac.uk/Projects/S_suis/


== Format the input data
$ java -jar ConvertFastaForCloud.jar s_suis.fa s_suis.br
$ java -jar ConvertFastaForCloud.jar 100k.fa 100k.br
s_suis.br: reference genome in CloudBurst binary format
100k.br:   Reads in CloudBurst binary format


... 생략 ...


[hadoop@skcc-nebdap02 CloudBurst-1.1.0]$ head s_suis.fa
>Streptococcus_suis
atgaaccaagaacaacttttttggcaacgatttattgaattggcaaaggtaaattttaag
ccatctatttatgatttttatgtcgctgatgcaaaattactcggaatcaaccagcaagtt
gccaatattttcttaaatcgtccatttaaaaaagatttctgggaaaaaaacttcgaagag
ttaatgattgccgctagttttgaaagctacggagagcctcttaccatccaatatcaattt
... 생략 ...
acagaggatgaacaggagattaggaatactacaaacacaagaagttcaatagttcaccag
gtacagacacttgagccggctactcctcaagaaacttttaaaccggttcattctgatata
aaatcccagtacacctttgctaattttgtacaaggagacaataatcactgggcaaaggct
gcagctttagctgtatctgataacctaggtgagctctacaatccattattcatttttggt
ggtcctggtcttggaaaaactcatattttaaatgcgattggaaataaggttctagccgat
[hadoop@skcc-nebdap02 CloudBurst-1.1.0]$ wc -l s_suis.fa
33460 s_suis.fa
[hadoop@skcc-nebdap02 CloudBurst-1.1.0]$ head 100k.fa
>1
GCCTGTTCTTTACATGATTTTTGGTCTAGTGTATGG
>2
AACCGCTGTAAAGGCTTCTGCCACACCGATTTCTTG
>3
GAGGTGATTGTGGTATTGT.GGTAAATCGGTGATTG
>4
GCTTTAGCCGACCTGAACT.GACTACAAGTTGACCA
>5
AAAGGCTACCCGCGGTTGAACCTTACGTGACACATT
[hadoop@skcc-nebdap02 CloudBurst-1.1.0]$ tail 100k.fa
>99996
AATGCCCGTAACAACGGGCTTTTATCTTGTTCTAAA
>99997
GTCAGATAGCGCAGGAATTTCAAAGGAATTTGGACC
>99998
AGTTAACTCTTCAGCTGTAAAGTTGTAGTTTTCTAA
>99999
GCGGCATAAATTGGATAAAGAAAGAACTGAAGGACA
>100000
GTTACCATGTATTGTGACAGATAACCACGGTGGAGT
[hadoop@skcc-nebdap02 hadoop]$ bin/hadoop dfs -mkdir /data/cloudburst
[hadoop@skcc-nebdap02 hadoop]$ bin/hadoop dfs -put ../CloudBurst-1.1.0/s_suis.br /data/cloudburst
[hadoop@skcc-nebdap02 hadoop]$ bin/hadoop dfs -put ../CloudBurst-1.1.0/100k.br /data/cloudburst
[hadoop@skcc-nebdap02 hadoop]$ bin/hadoop jar ../CloudBurst-1.1.0/CloudBurst.jar
Usage: CloudBurst refpath qrypath outpath minreadlen maxreadlen k allowdifferences filteralignments #mappers #reduces
#fmappers #freducers blocksize redundancy


1. refpath:         path in hdfs to the reference file
2. qrypath:         path in hdfs to the query file
3. outpath:         path to a directory to store the results (old results are automatically deleted)
4. minreadlen:        minimum length of the reads
5. maxreadlen:         maximum read length
6. k:             number of mismatches / differences to allow (higher number requires more time)
7. allowdifferences: 0: mismatches only, 1: indels as well
8. filteralignments: 0: all alignments, 1: only report unambiguous best alignment (results identical to RMAP)
9. #mappers:          number of mappers to use.             suggested: #processor-cores * 10
10. #reduces:        number of reducers to use.            suggested: #processor-cores * 2
11. #fmappers:        number of mappers for filtration alg. suggested: #processor-cores
12. #freducers:       number of reducers for filtration alg. suggested: #processor-cores
13. blocksize:       number of qry and ref tuples to consider at a time in the reduce phase. suggested: 128
14. redundancy:        number of copies of low complexity seeds to use. suggested: # processor cores
[hadoop@skcc-nebdap02 hadoop]$ bin/hadoop jar ../CloudBurst-1.1.0/CloudBurst.jar /data/cloudburst/s_suis.br
/data/cloudburst/100k.br /data/results 36 36 3 0 1 240 48 24 24 128 16 >& cloudburst.err
[hadoop@skcc-nebdap02 hadoop]$ cat cloudburst.err
refath: /data/cloudburst/s_suis.br
qrypath: /data/cloudburst/100k.br
outpath: /data/results-alignments
MIN_READ_LEN: 36
MAX_READ_LEN: 36
K: 3
SEED_LEN: 9
FLANK_LEN: 30
ALLOW_DIFFERENCES: 0
FILTER_ALIGNMENTS: true
NUM_MAP_TASKS: 240
NUM_REDUCE_TASKS: 48
BLOCK_SIZE: 128
REDUNDANCY: 16
 Removing old results
12/06/15 17:11:27 WARN mapred.JobClient: Use GenericOptionsParser for parsing the arguments. Applications should
implement Tool for the same.
12/06/15 17:11:28 INFO mapred.FileInputFormat: Total input paths to process : 2
12/06/15 17:11:28 INFO mapred.JobClient: Running job: job_201206112243_0018
12/06/15 17:11:29 INFO mapred.JobClient: map 0% reduce 0%
12/06/15 17:11:47 INFO mapred.JobClient: map 12% reduce 0%
12/06/15 17:11:48 INFO mapred.JobClient: map 14% reduce 0%
12/06/15 17:11:49 INFO mapred.JobClient: map 15% reduce 0%
12/06/15 17:11:50 INFO mapred.JobClient: map 17% reduce 0%
12/06/15 17:11:51 INFO mapred.JobClient: map 19% reduce 0%
12/06/15 17:11:52 INFO mapred.JobClient: map 21% reduce 0%
12/06/15 17:11:53 INFO mapred.JobClient: map 36% reduce 0%
12/06/15 17:11:54 INFO mapred.JobClient: map 40% reduce 0%
12/06/15 17:11:55 INFO mapred.JobClient: map 45% reduce 0%
12/06/15 17:11:56 INFO mapred.JobClient: map 49% reduce 0%
12/06/15 17:11:57 INFO mapred.JobClient: map 56% reduce 0%
12/06/15 17:11:58 INFO mapred.JobClient: map 57% reduce 0%
12/06/15 17:11:59 INFO mapred.JobClient: map 74% reduce 0%
12/06/15 17:12:00 INFO mapred.JobClient: map 80% reduce 1%
12/06/15 17:12:01 INFO mapred.JobClient: map 80% reduce 2%
12/06/15 17:12:02 INFO mapred.JobClient: map 83% reduce 3%
12/06/15 17:12:03 INFO mapred.JobClient: map 91% reduce 4%
12/06/15 17:12:05 INFO mapred.JobClient: map 95% reduce 6%
12/06/15 17:12:06 INFO mapred.JobClient: map 95% reduce 9%
12/06/15 17:12:07 INFO mapred.JobClient: map 95% reduce 10%
12/06/15 17:12:08 INFO mapred.JobClient: map 100% reduce 14%
12/06/15 17:12:09 INFO mapred.JobClient: map 100% reduce 17%
12/06/15 17:12:10 INFO mapred.JobClient: map 100% reduce 18%
12/06/15 17:12:11 INFO mapred.JobClient: map 100% reduce 22%
12/06/15 17:12:13 INFO mapred.JobClient: map 100% reduce 23%
12/06/15 17:12:14 INFO mapred.JobClient: map 100% reduce 28%
12/06/15 17:12:15 INFO mapred.JobClient: map 100% reduce 31%
12/06/15 17:12:17 INFO mapred.JobClient: map 100% reduce 51%
12/06/15 17:12:18 INFO mapred.JobClient: map 100% reduce 65%
12/06/15 17:12:19 INFO mapred.JobClient: map 100% reduce 70%
12/06/15 17:12:20 INFO mapred.JobClient: map 100% reduce 87%
12/06/15 17:12:21 INFO mapred.JobClient: map 100% reduce 92%
12/06/15 17:12:22 INFO mapred.JobClient: map 100% reduce 94%
12/06/15 17:12:23 INFO mapred.JobClient: map 100% reduce 98%
12/06/15 17:12:26 INFO mapred.JobClient: map 100% reduce 100%
12/06/15 17:12:31 INFO mapred.JobClient: Job complete: job_201206112243_0018
12/06/15 17:12:32 INFO mapred.JobClient: Counters: 31
12/06/15 17:12:32 INFO mapred.JobClient:   Job Counters
12/06/15 17:12:32 INFO mapred.JobClient:    Launched reduce tasks=48
12/06/15 17:12:32 INFO mapred.JobClient:    SLOTS_MILLIS_MAPS=2980992
12/06/15 17:12:32 INFO mapred.JobClient:    Total time spent by all reduces waiting after reserving slots (ms)=0
12/06/15 17:12:32 INFO mapred.JobClient:    Total time spent by all maps waiting after reserving slots (ms)=0
12/06/15 17:12:32 INFO mapred.JobClient:    Rack-local map tasks=158
12/06/15 17:12:32 INFO mapred.JobClient:    Launched map tasks=241
12/06/15 17:12:32 INFO mapred.JobClient:    Data-local map tasks=83
12/06/15 17:12:32 INFO mapred.JobClient:    SLOTS_MILLIS_REDUCES=1106915
12/06/15 17:12:32 INFO mapred.JobClient:   File Input Format Counters
12/06/15 17:12:32 INFO mapred.JobClient:    Bytes Read=5587101
12/06/15 17:12:32 INFO mapred.JobClient:   File Output Format Counters
12/06/15 17:12:32 INFO mapred.JobClient:    Bytes Written=2707836
12/06/15 17:12:32 INFO mapred.JobClient:   FileSystemCounters
12/06/15 17:12:32 INFO mapred.JobClient:    FILE_BYTES_READ=140515797
12/06/15 17:12:32 INFO mapred.JobClient:    HDFS_BYTES_READ=6112267
12/06/15 17:12:32 INFO mapred.JobClient:    FILE_BYTES_WRITTEN=288167030
12/06/15 17:12:32 INFO mapred.JobClient:    HDFS_BYTES_WRITTEN=2707836
12/06/15 17:12:32 INFO mapred.JobClient:   Map-Reduce Framework
12/06/15 17:12:32 INFO mapred.JobClient:    Map output materialized bytes=140584917
12/06/15 17:12:32 INFO mapred.JobClient:    Map input records=100032
12/06/15 17:12:32 INFO mapred.JobClient:    Reduce shuffle bytes=140436273
12/06/15 17:12:32 INFO mapred.JobClient:    Spilled Records=5558658
12/06/15 17:12:32 INFO mapred.JobClient:    Map output bytes=134956851
12/06/15 17:12:32 INFO mapred.JobClient:    Total committed heap usage (bytes)=57936314368
12/06/15 17:12:32 INFO mapred.JobClient:    CPU time spent (ms)=1693370
12/06/15 17:12:32 INFO mapred.JobClient:    Map input bytes=5073092
12/06/15 17:12:32 INFO mapred.JobClient:    SPLIT_RAW_BYTES=24638
12/06/15 17:12:32 INFO mapred.JobClient:    Combine input records=0
12/06/15 17:12:32 INFO mapred.JobClient:    Reduce input records=2774585
12/06/15 17:12:32 INFO mapred.JobClient:     Reduce input groups=254196
12/06/15 17:12:32 INFO mapred.JobClient:     Combine output records=0
12/06/15 17:12:32 INFO mapred.JobClient:     Physical memory (bytes) snapshot=57459982336
12/06/15 17:12:32 INFO mapred.JobClient:     Reduce output records=81128
12/06/15 17:12:32 INFO mapred.JobClient:     Virtual memory (bytes) snapshot=754874736640
12/06/15 17:12:32 INFO mapred.JobClient:     Map output records=2779329
CloudBurst Finished
Alignment time: 65.36
NUM_FMAP_TASKS: 24
NUM_FREDUCE_TASKS: 24
 Removing old results
12/06/15 17:12:32 WARN mapred.JobClient: Use GenericOptionsParser for parsing the arguments. Applications should
implement Tool for the same.
12/06/15 17:12:32 INFO mapred.FileInputFormat: Total input paths to process : 48
12/06/15 17:12:39 INFO mapred.JobClient: Running job: job_201206112243_0019
12/06/15 17:12:40 INFO mapred.JobClient: map 0% reduce 0%
12/06/15 17:12:54 INFO mapred.JobClient: map 62% reduce 0%
12/06/15 17:12:55 INFO mapred.JobClient: map 100% reduce 0%
12/06/15 17:13:06 INFO mapred.JobClient: map 100% reduce 16%
12/06/15 17:13:07 INFO mapred.JobClient: map 100% reduce 33%
12/06/15 17:13:09 INFO mapred.JobClient: map 100% reduce 58%
12/06/15 17:13:10 INFO mapred.JobClient: map 100% reduce 75%
12/06/15 17:13:12 INFO mapred.JobClient: map 100% reduce 87%
12/06/15 17:13:13 INFO mapred.JobClient: map 100% reduce 91%
12/06/15 17:13:15 INFO mapred.JobClient: map 100% reduce 100%
12/06/15 17:13:20 INFO mapred.JobClient: Job complete: job_201206112243_0019
12/06/15 17:13:20 INFO mapred.JobClient: Counters: 31
12/06/15 17:13:20 INFO mapred.JobClient:    Job Counters
12/06/15 17:13:20 INFO mapred.JobClient:     Launched reduce tasks=24
12/06/15 17:13:20 INFO mapred.JobClient:     SLOTS_MILLIS_MAPS=207232
12/06/15 17:13:20 INFO mapred.JobClient:     Total time spent by all reduces waiting after reserving slots (ms)=0
12/06/15 17:13:20 INFO mapred.JobClient:     Total time spent by all maps waiting after reserving slots (ms)=0
12/06/15 17:13:20 INFO mapred.JobClient:     Rack-local map tasks=5
12/06/15 17:13:20 INFO mapred.JobClient:     Launched map tasks=48
12/06/15 17:13:20 INFO mapred.JobClient:     Data-local map tasks=43
12/06/15 17:13:20 INFO mapred.JobClient:     SLOTS_MILLIS_REDUCES=245651
12/06/15 17:13:20 INFO mapred.JobClient:    File Input Format Counters
12/06/15 17:13:20 INFO mapred.JobClient:     Bytes Read=2707836
12/06/15 17:13:20 INFO mapred.JobClient:     File Output Format Counters
12/06/15 17:13:20 INFO mapred.JobClient:      Bytes Written=2485042
12/06/15 17:13:20 INFO mapred.JobClient:     FileSystemCounters
12/06/15 17:13:20 INFO mapred.JobClient:      FILE_BYTES_READ=2188332
12/06/15 17:13:20 INFO mapred.JobClient:      HDFS_BYTES_READ=2713260
12/06/15 17:13:20 INFO mapred.JobClient:      FILE_BYTES_WRITTEN=6039532
12/06/15 17:13:20 INFO mapred.JobClient:      HDFS_BYTES_WRITTEN=2485042
12/06/15 17:13:20 INFO mapred.JobClient:     Map-Reduce Framework
12/06/15 17:13:20 INFO mapred.JobClient:      Map output materialized bytes=2195100
12/06/15 17:13:20 INFO mapred.JobClient:      Map input records=81128
12/06/15 17:13:20 INFO mapred.JobClient:      Reduce shuffle bytes=2153793
12/06/15 17:13:20 INFO mapred.JobClient:      Spilled Records=162088
12/06/15 17:13:20 INFO mapred.JobClient:      Map output bytes=2028200
12/06/15 17:13:20 INFO mapred.JobClient:      Total committed heap usage (bytes)=14471921664
12/06/15 17:13:20 INFO mapred.JobClient:      CPU time spent (ms)=95390
12/06/15 17:13:20 INFO mapred.JobClient:      Map input bytes=2703324
12/06/15 17:13:20 INFO mapred.JobClient:      SPLIT_RAW_BYTES=5424
12/06/15 17:13:20 INFO mapred.JobClient:      Combine input records=81128
12/06/15 17:13:20 INFO mapred.JobClient:      Reduce input records=81044
12/06/15 17:13:20 INFO mapred.JobClient:      Reduce input groups=76511
12/06/15 17:13:20 INFO mapred.JobClient:      Combine output records=81044
12/06/15 17:13:20 INFO mapred.JobClient:      Physical memory (bytes) snapshot=13169172480
12/06/15 17:13:20 INFO mapred.JobClient:      Reduce output records=74502
12/06/15 17:13:20 INFO mapred.JobClient:      Virtual memory (bytes) snapshot=193761902592
12/06/15 17:13:20 INFO mapred.JobClient:      Map output records=81128
FilterAlignments Finished
Filtering time: 48.481
Total Running time: 113.841
[hadoop@skcc-nebdap02 hadoop]$
[hadoop@skcc-nebdap02 hadoop]$ bin/hadoop dfs -get /data/results/ ../CloudBurst-1.1.0/results
[hadoop@skcc-nebdap02 hadoop]$ cd ../CloudBurst-1.1.0
[hadoop@skcc-nebdap02 CloudBurst-1.1.0]$ java -jar PrintAlignments.jar results | sort -nk4 > 100k.3.txt
[hadoop@skcc-nebdap02 CloudBurst-1.1.0]$ head -n 20 100k.3.txt
1     766133 766169 1         1     +
1     297899 297935 2         0     -
1     1325118 1325154 4       1      +
1     145970 146006 7         1     -
1     553513 553549 8         0     -
1    1779842 1779878 9        0               -
1    86299    86335   10      0           -
1    1503808 1503844 11           2           +
1    397758 397794 12         0               +
1    241778 241814 13         0               -
1    626711 626747 14         0               +
1    142141 142177 15         1               +
1    1401129 1401165 16           1           -
1    306289 306325 17         1               +
1    628571 628607 18         1               -
1    815172 815208 19         0               -
1    1624600 1624636 20           0           +
1    13779    13815   21      0           +
1    129064 129100 22         1               +
1    1382938 1382974 24           2           +
[hadoop@skcc-nebdap02 CloudBurst-1.1.0]$ tail -n 20 100k.3.txt
1    1796768 1796804 99976            2               -
1    1021128 1021164 99978            0               -
1    1350005 1350041 99980            1               +
1    799280 799316 99981              2           -
1    139518 139554 99983              0           +
1    57158    57194   99985       0               +
1    1663030 1663066 99986            2               +
1    549235 549271 99987              0           -
1    1400509 1400545 99988            0               +
1    880593 880629 99989              0           +
1    918064 918100 99990              0           +
1    937994 938030 99992              1           -
1    94456    94492   99993       0               +
1    1144320 1144356 99994            0               +
1    1441627 1441663 99995            0               +
1    1281557 1281593 99996            0               +
1    1323611 1323647 99997            2               -
1    800095 800131 99998              0           -
1    1956458 1956494 99999            1               +
1    134848 134884 100000 2                           -
[hadoop@skcc-nebdap02 CloudBurst-1.1.0]$ wc -l 100k.3.txt
74502 100k.3.txt
Cloud burst tutorial