Given a Hidden Markov Model and a bunch of observation sequences, compute the most likely path for each observation sequence.
The project consists of a few different parts. A generic library and some applications. The applications are:
- A standalone scala app
- A hadoop job
- A http server
- A thrift server
- A prestodb plugin
Javadocs for the library can be found here
Typical usage of the library looks like this.
// args = {pi, A, B, T, input, output};
Function<String, InputStream> r = DNAViterbiApp.class::getResourceAsStream;
HMM hmm = new HMM.Builder()
.fromInputStreams(r.apply(args[0]), r.apply(args[1]), r.apply(args[2]))
.adjacency()
.build();
Viterbi<String,FullResult> viterbi =
new Viterbi.Builder<String,String,FullResult>()
.withHMM(hmm)
.withMaxObservationLength(Integer.parseInt(args[3]))
.withObservationEncoder(new DNAEncoder())
.withObservationDecoder(new DNADecoder())
.withPathDecoder(new StringDecoder())
.withResultFactoryClass("com.github.sorhus.hmmongo.viterbi.result.FullResultFactory")
.build();
The library is written in Java 8.
Note that the DNAEncoder, DNADecoder and StringDecoder requires scala 2.11 to run.
Also, in libhmm/src/main/resources there is an HMM that models the T-cell receptor.
mvn clean package
scala -cp libhmm/target/libhmm-0.3.0.jar com.github.sorhus.hmmongo.DNAViterbiApp /example_pi.gz /example_A.gz /example_B.gz 41 libhmm/src/main/resources/example_input output
java -jar scalatra/target/scalatra-0.3.0.jar /example_pi.gz /example_A.gz /example_B.gz 101curl localhost:8080/acgttgcatcgatcgatcgatcgatcgtacgatcgatcgaacgatgcgactaca
java -jar thrift/target/thrift-0.3.0.jar /example_pi.gz /example_A.gz /example_B.gz 101- There is an example client that can be tested as follows
java -cp thrift/target/thrift-0.3.0.jar com.github.sorhus.hmmongo.thrift.client.DNAViterbiClient
hadoop jar hadoop/target/hadoop-0.3.0.jar com.twitter.scalding.Tool com.github.sorhus.hmmongo.DNAViterbiJob --local --pi hadoop/src/main/resources/example_pi.gz --A hadoop/src/main/resources/example_A.gz --B hadoop/src/main/resources/example_B.gz --T 101 --input hadoop/src/main/resources/example_input --output output
- If the HMM is big:
export HADOOP_CLIENT_OPT=-Xmx2g - Put the input on hdfs
hadoop jar hadoop/target/hadoop-0.3.0.jar com.twitter.scalding.Tool com.github.sorhus.hmmongo.DNAViterbiJob --hdfs --pi src/main/resources/tcrb_pi.gz --A src/main/resources/tcrb_A.gz --B src/main/resources/tcrb_B.gz --T 101 --input /user/anton/SRR060692_1.sample --output /user/anton/output
- Put the jar in the presto plugin direcory, i.e.
presto/plugin/hmmongo/presto-0.4.0.jar - Put a config in the presto etc directory
cat >> etc/plugin/viterbi.properties <<EOF
pi.location=/path/to/pi
A.location=/path/to/A
B.location=/path/to/B
T=100
EOF
- Test the function like so
presto> select viterbi('name','acgt');
_col0
---------
1,1,2,2
(1 row)