Documentation Index
Fetch the complete documentation index at: /llms.txt
Use this file to discover all available pages before exploring further.
Tested Python solution for LeetCode 187 with 17 pytest cases. Generate a practice environment with lcpy.
lcpy gen -n 187 # by problem number
lcpy gen -s repeated_dna_sequences # by problem name
'A', 'C', 'G', and 'T'.
"ACGAATTCCG" is a DNA sequence.s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.
Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC","CCCCCAAAAA"]
Input: s = "AAAAAAAAAAAAA"
Output: ["AAAAAAAAAA"]
s[i] is either 'A', 'C', 'G', or 'T'.class Solution:
# Time: O(n * L) where L is the sequence length (10)
# Space: O(n * L)
def repeated_dna_sequences(self, s: str) -> list[str]:
seen: set[str] = set()
repeated: set[str] = set()
for i in range(len(s) - 9):
sequence = s[i : i + 10]
if sequence in seen:
repeated.add(sequence)
seen.add(sequence)
return list(repeated)
| Time | Space |
|---|---|
| O(n * L) where L is the sequence length (10) | O(n * L) |